Search Results
7 results for search term 'ai9' in category Model System
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Ai9 mouse (BCM)Model System - [In Vivo] [Mouse] |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
Ai9 mouse immortalized fibroblastsModel System - [In Vitro] [Mouse] |
HEK-293T with Ai9 transient reporter assayModel System - [In Vitro] [Human]Show Experiments (1) |
Ai14 mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
Ai14 mouseModel System - [In Vivo] [Mouse] |
7 results for search term 'ai9' in category Model System
| Type | Organism | Subtype | Name | Description | Source | View Associated... |
|---|---|---|---|---|---|---|
| Animal | Mouse | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
|
| Animal | Mouse | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | ||
| Animal | Mouse | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | ||
| Cell | Mouse | Immortalized Fibroblast (unspecified) | Ai9 mouse immortalized fibroblasts | Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice | ||
| Cell | Human | Immortalized | HEK-293T with Ai9 transient reporter assay | HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
| Animal | Mouse | Ai14 mouse (congenic) | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |
Show Experiments (7)
|
|
| Animal | Mouse | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |